Walter Simons (walter_simons) wrote,
Walter Simons
walter_simons

Цифруем ДНК!

Начнем с того, что информация имеет в своей основе бит. Бит может быть равен 1 либо 0, бит это минимальная порция информации, ее элементарная частица. Любую информацию можно представить в виде битов. На этом основаны все цифровые методы записи: состояние триггера в микросхеме, или магнитных зерен на поверхности дискеты, отражают состояния бита 1 или 0. В ДНК прослеживается та же система. Нуклеотиды можно рассматривать как числа. Дело в том, что нуклеотиды А, G, T, C, имеют каждый свой определенный информационный эквивалент, причем равный паре бит!
Нуклеотид Сокращение Двоичный эквивалент
Гуанин G 00
Аденин A 01
Тимин T 10
Цитозин C 11

Допустим А = 01 (в двоичной системе), тогда комплиментарный ему Т = 10, G = 00 и С = 11. Иначе говоря получается четвертичная система исчисления. Для примера возьмем 1 байт в десятичной системе = 145 в двоичной 10010001 и запишем его в формате ДНК! Сначала, разобьем 8 бит по парам 10, 01, 00, 01 Всего пар 4, значит для записи нам нужно будет 4 нуклеотида. Сверяясь с таблицей запишем их: Т(10), А(01), G(00), A(01) Получается олигонуклиотид: TAGA Система работает в обе стороны и вы можете получить из ДНК (TAGA) байт равный 145. Ну а раз мы уже смогли записать и прочесть байт, то, по той же схеме, в принципе, можно записать и большее количество информации! Для таких целей была составлена специальная программа Вот, к примеру данная последовательность:

CACACCGTCTCTGTGGCCGACTCTCTCTCTGACCTACTAACTCACTTGCTAAGTGGGTGGCTACCTGGCTCCCTTGCCGACTGGCTCACTCTG TGGCTCACTGGGTGGCGAGCGCACGTTGTGA
Преобразовав эту запись таким методом вы получите следующую байтовую последовательность:
Текст DEC HEX# DNA
1 Э 221 DD CACA
2 т 242 F2 CCGT
3 о 238 EE CTCT
4   32 20 GTGG
5 с 241 F1 CCGA
6 о 238 EE CTCT
7 о 338 EE CTCT
8 б 225 E1 CTGA
9 щ 249 F9 CCTA
10 е 229 E5 CTAA
11 н 237 ED CTCA
... ... ... ... ...

В привычном для пользователей, текстовом формате, это означает: "Это
сообщение записано на ДНК!"

При этом, если синтезировать молекулу ДНК с
данной записью, то она была бы в длину менее 700 Ангстрем, что гораздо меньше
любой бактерии или вируса! Это была бы запись на молекулярном уровне! 


При этом в формат ДНК можно перевести любой файл, графику, звукозапись,
таблицу и т. д., и гарантировано расшифровать его обратно. На данный момент, по
разработанному методу, в лаборатории удалось реально записать на молекулу ДНК
файл размером 8 байт.


Догадайтесь терерь сами, как можно импользовать этот метод?! :)
Subscribe
promo walter_simons august 13, 2013 13:43 Leave a comment
Buy for 100 tokens
***
...
  • Post a new comment

    Error

    default userpic

    Your reply will be screened

    When you submit the form an invisible reCAPTCHA check will be performed.
    You must follow the Privacy Policy and Google Terms of use.
  • 11 comments